| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.119328 |
| Chromosome: | chromosome 10 |
| Location: | 3502011 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g445050 | SLT3 | (1 of 1) IPR001898//IPR004680//IPR006037 - Sodium/sulphate symporter // Citrate transporter-like domain // Regulator of K+ conductance, C-terminal; Sodium/sulfate co-transporter 3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGACAACGCGCCGTGAGTCAAAGCTATC |
| Internal bar code: | AATGCGGCAGCGGTAACAAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 953 |
| LEAP-Seq percent confirming: | 99.4981 |
| LEAP-Seq n confirming: | 2577 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAGCATGGGGTAAGAACC |
| Suggested primer 2: | GCTGGAGAGCACAAGGAAAC |