Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.119365 |
Chromosome: | chromosome 5 |
Location: | 799172 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g248200 | (1 of 2) PTHR21493//PTHR21493:SF124 - CGI-141-RELATED/LIPASE CONTAINING PROTEIN // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACACAAGCCAGAACGCACACCCACACATA |
Internal bar code: | GGGCGCCGCCATCTCGGACCCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 0.0725163 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 1378 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAAAACAACAACGCACACC |
Suggested primer 2: | GATAACGTGGCTGGCTGAAT |