Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.119373 |
Chromosome: | chromosome 8 |
Location: | 1385749 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g364100 | (1 of 1) PF13449 - Esterase-like activity of phytase (Phytase-like) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCCCCGACCGACTGACCCAAGCACCTT |
Internal bar code: | CGATGTGGTAGAGGTCGTCTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 761 |
LEAP-Seq percent confirming: | 99.4259 |
LEAP-Seq n confirming: | 12124 |
LEAP-Seq n nonconfirming: | 70 |
LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGACCAGCAGAGCATACA |
Suggested primer 2: | AGTGAAACAAAATGGACGCC |