| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.119373 |
| Chromosome: | chromosome 8 |
| Location: | 1385749 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g364100 | (1 of 1) PF13449 - Esterase-like activity of phytase (Phytase-like) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGCCCCGACCGACTGACCCAAGCACCTT |
| Internal bar code: | CGATGTGGTAGAGGTCGTCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 761 |
| LEAP-Seq percent confirming: | 99.4259 |
| LEAP-Seq n confirming: | 12124 |
| LEAP-Seq n nonconfirming: | 70 |
| LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGACCAGCAGAGCATACA |
| Suggested primer 2: | AGTGAAACAAAATGGACGCC |