| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.119374 |
| Chromosome: | chromosome 6 |
| Location: | 7991802 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g303900 | (1 of 1) PTHR20855:SF52 - ADIPONECTIN RECEPTOR PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAATCGAATGCAATTAAACAAAACTGGA |
| Internal bar code: | GGCACGTTGGCCTGCTAAGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 649 |
| LEAP-Seq percent confirming: | 99.7346 |
| LEAP-Seq n confirming: | 2631 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCCTCTCATGTCTCCTCC |
| Suggested primer 2: | AAACAAGCCATCAAAAACGG |