| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.119377 |
| Chromosome: | chromosome 2 |
| Location: | 2349916 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g090900 | MCP9 | (1 of 15) IPR002067//IPR018108//IPR023395 - Mitochondrial carrier protein // Mitochondrial substrate/solute carrier // Mitochondrial carrier domain; Mitochondrial substrate carrier protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTACGCCCATCTAACTAACCTTGGGTGCG |
| Internal bar code: | GGGTATCTCCGTGGTAGTAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 736 |
| LEAP-Seq percent confirming: | 67.3537 |
| LEAP-Seq n confirming: | 11634 |
| LEAP-Seq n nonconfirming: | 5639 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCAACATTCCGTACGAGC |
| Suggested primer 2: | GCAACCTCTGGACCTAGCAG |