| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.119411 |
| Chromosome: | chromosome 1 |
| Location: | 975401 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g005400 | SDR1 | Short-chain dehydrogenase/reductase; (1 of 23) PF13561 - Enoyl-(Acyl carrier protein) reductase (adh_short_C2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAACCATTATTGGATCTCCTGGGAAGGC |
| Internal bar code: | TACCTTTCATTGGGAATATCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 695 |
| LEAP-Seq percent confirming: | 98.9414 |
| LEAP-Seq n confirming: | 9533 |
| LEAP-Seq n nonconfirming: | 102 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGTGGGTTATGTGGATAG |
| Suggested primer 2: | AGCAACGTCAGGTGGGTATC |