| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.119445 |
| Chromosome: | chromosome 3 |
| Location: | 8888518 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g207713 | ISA3 | Isoamylase, starch debranching enzyme 3; (1 of 2) 3.2.1.68 - Isoamylase / Debranching enzyme | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAAGCATGCACACACAGCGCTGCCGGTTT |
| Internal bar code: | TATGTTCGGTGTGTCCCAGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 81 |
| LEAP-Seq percent confirming: | 97.4082 |
| LEAP-Seq n confirming: | 1353 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAAGACACGCCCTCATAC |
| Suggested primer 2: | CACTCTAGAGCTGCCCAACC |