Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.119453 |
Chromosome: | chromosome 2 |
Location: | 73215 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g073650 | PRP19 | Spliceosome Component, nuclear pre-mRNA splicing factor; (1 of 1) K10599 - pre-mRNA-processing factor 19 (PRPF19, PRP19) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCCACACACGCCCTCCACATAACCGCTT |
Internal bar code: | GTGCCTCACTTCTCGGGCCGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 176 |
LEAP-Seq percent confirming: | 60.0 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAGAATGCACAGTCAAGCC |
Suggested primer 2: | CTCCATGGTGGAGACTTGGT |