Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.119458 |
Chromosome: | chromosome 6 |
Location: | 5423613 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g284150 | RH2,RHP2 | (1 of 2) K06580 - ammonium transporter Rh (SLC42A, RHAG, RHBG, RHCG); Rhesus protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGTATGAACATAACAGGGGGTCGAACACA |
Internal bar code: | TACGCGTCACCGTTCTGGTGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 58 |
LEAP-Seq percent confirming: | 93.4783 |
LEAP-Seq n confirming: | 43 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACAGCAGCAACAGCAAATG |
Suggested primer 2: | CGGCACAGAGCAGAATGTAA |