| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.119556 |
| Chromosome: | chromosome 3 |
| Location: | 2541567 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g160200 | P4H12,PHX7,PFH12,Cr-P4H-1 | (1 of 2) IPR003582//IPR005123//IPR006620//IPR027450 - ShKT domain // Oxoglutarate/iron-dependent dioxygenase // Prolyl 4-hydroxylase, alpha subunit // Alpha-ketoglutarate-dependent dioxygenase AlkB-like; Prolyl 4-hydroxylase 12 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGATAGTTGTAATGGCGTGTTGCACGT |
| Internal bar code: | GAGGTTGGCTAAACGTATACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 628 |
| LEAP-Seq percent confirming: | 97.6945 |
| LEAP-Seq n confirming: | 2712 |
| LEAP-Seq n nonconfirming: | 64 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCCTGGTGCTTATCGTGT |
| Suggested primer 2: | AGGTTGGGTTTAGTTCGCCT |