| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.119586 |
| Chromosome: | chromosome 11 |
| Location: | 2533690 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g476050 | DYHG,ODA2,DHC15,ODA-DHCgamma,PF28 | Flagellar outer arm dynein heavy chain gamma; (1 of 1) PTHR10676//PTHR10676:SF35 - DYNEIN HEAVY CHAIN FAMILY PROTEIN // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTAATGAATGGGTGACACGCTCTTCTATC |
| Internal bar code: | GCGGATCTCGTTAGGTAACGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 853 |
| LEAP-Seq percent confirming: | 99.8151 |
| LEAP-Seq n confirming: | 3778 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGGTGAGTTTGGGTTCCT |
| Suggested primer 2: | AGGAATTTTGATGGTGGCTG |