| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.119607 |
| Chromosome: | chromosome 11 |
| Location: | 2065252 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g468750 | CPLD48 | Conserved in the Plant Lineage and Diatoms; (1 of 3) PF07386 - Protein of unknown function (DUF1499) (DUF1499) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGTGCCCTCCCTCGCCCAACTGCATTG |
| Internal bar code: | GGGCCTTGGGGGTTGAGGTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 938 |
| LEAP-Seq percent confirming: | 86.2094 |
| LEAP-Seq n confirming: | 5970 |
| LEAP-Seq n nonconfirming: | 955 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCCAACTTGTGAGTCCA |
| Suggested primer 2: | CCCCGCCTCTTTTACTCTTC |