| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.119608 |
| Chromosome: | chromosome 11 |
| Location: | 121701 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467538 | GOX10,GOX8 | (1 of 20) PTHR32208//PTHR32208:SF21 - FAMILY NOT NAMED // F10A5.18; Glyoxal oxidase 8 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCAGGCCCACACCGCGCCCAGACAACCC |
| Internal bar code: | GGTTTGGTCGGTACCGAGGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 826 |
| LEAP-Seq percent confirming: | 98.1702 |
| LEAP-Seq n confirming: | 3380 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACAAAACAAATCCCGAGCC |
| Suggested primer 2: | GGCAAGAATCCCATCTACGA |