Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.119679 |
Chromosome: | chromosome 2 |
Location: | 6077792 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g112900 | TPT6,TPT5 | (1 of 3) K15356 - GDP-mannose transporter (VRG4, GONST1); Putative GDP-mannose transporter | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTACAGCCGCGACCGGGGCCTACACTGGC |
Internal bar code: | CTCGCTTAATGAGTCAGGATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1100 |
LEAP-Seq percent confirming: | 99.6901 |
LEAP-Seq n confirming: | 9329 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAGGGAAGGAGGATAAGG |
Suggested primer 2: | CTTGTTGTGCGTGGACACTT |