| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.119710 |
| Chromosome: | chromosome 6 |
| Location: | 1687410 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g261200 | ERG5,ERG25 | Sterol desaturase/putative lathosterol oxidase; (1 of 1) PTHR11863//PTHR11863:SF2 - STEROL DESATURASE // PROTEIN ECERIFERUM 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCATTGCGTTTTGACACACACGCACAGG |
| Internal bar code: | AAGCGTATATACTTTGTAGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 19 |
| LEAP-Seq percent confirming: | 39.1304 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCAGTGCATAACAAGGCTA |
| Suggested primer 2: | CTAGGGGCACACACACACAC |