| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.119718 |
| Chromosome: | chromosome 6 |
| Location: | 2454119 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g268750 | MME1,MME | (1 of 1) 1.1.1.39 - Malate dehydrogenase (decarboxylating) / Pyruvic-malic carboxylase; Malate dehydrogenase 1, decarboxylating | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCTTGTTGACCTTTCTGGCTTTCCCTGC |
| Internal bar code: | CTCTTATGAGACGGCGGGGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 703 |
| LEAP-Seq percent confirming: | 99.8337 |
| LEAP-Seq n confirming: | 1201 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTACTGTTCAGCCACAGCG |
| Suggested primer 2: | CACCCCCTACACTTGCATCT |