| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.119722 |
| Chromosome: | chromosome 17 |
| Location: | 1940534 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g710700 | (1 of 4) PTHR23257:SF490 - DUAL SPECIFICITY PROTEIN KINASE SHKE | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGGAACTGTGCAGCGCGCACATTTGGTGC |
| Internal bar code: | CAGAGTCGGTTAGCCCCGCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 821 |
| LEAP-Seq percent confirming: | 99.2231 |
| LEAP-Seq n confirming: | 894 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACTTATGCGGATCTGCCG |
| Suggested primer 2: | ATGACGGCATAACGTGCATA |