Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.119750 |
Chromosome: | chromosome 8 |
Location: | 1728509 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g366050 | (1 of 13) IPR000086//IPR015797 - NUDIX hydrolase domain // NUDIX hydrolase domain-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAGCACCAGTAAACAGTGAACATCGTAAT |
Internal bar code: | CGACACGGCTCCAGGCGGCAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 874 |
LEAP-Seq percent confirming: | 98.2268 |
LEAP-Seq n confirming: | 6038 |
LEAP-Seq n nonconfirming: | 109 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCGTCAATCGTCCACCTCT |
Suggested primer 2: | CGAGACGGCACTTTATGGAT |