Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.119754 |
Chromosome: | chromosome 10 |
Location: | 4582210 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g452550 | HOPP1,HOP1 | Homologous-pairing protein 1; (1 of 3) PF02301 - HORMA domain (HORMA) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACAGGGCCGGCCACAGGTCGCGGCTCAG |
Internal bar code: | TTTATGCTGAAGTCCCGCCTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 342 |
LEAP-Seq percent confirming: | 99.2757 |
LEAP-Seq n confirming: | 21245 |
LEAP-Seq n nonconfirming: | 155 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGGAAGAGCAAGCATACC |
Suggested primer 2: | TTCTTTGTTGCTGTTGCTGG |