| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.119756 |
| Chromosome: | chromosome 13 |
| Location: | 2376778 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g579400 | ERM8 | (1 of 13) PTHR13018//PTHR13018:SF5 - PROBABLE MEMBRANE PROTEIN DUF221-RELATED // PHOSPHATE METABOLISM PROTEIN 7; ERD4-related membrane protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTCATGCCTCCCCCGCCGCACGACACCA |
| Internal bar code: | GCCTAGCGCTCGGCTCCGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 991 |
| LEAP-Seq percent confirming: | 97.8261 |
| LEAP-Seq n confirming: | 180 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTCAGAACCAGGTAGGCA |
| Suggested primer 2: | GATGACTGTGAGCACCGAGA |