| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.119793 |
| Chromosome: | chromosome 1 |
| Location: | 3385720 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g021500 | (1 of 1) K15377 - solute carrier family 44 (choline transporter-like protein), member 2/4/5 (SLC44A2_4_5) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTGCTGATACGTACCGCAAAGTGCTGCA |
| Internal bar code: | TCTGCGTATGATCCAGAGCAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 705 |
| LEAP-Seq percent confirming: | 59.6241 |
| LEAP-Seq n confirming: | 1047 |
| LEAP-Seq n nonconfirming: | 709 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTTCACCTACGTGACCAT |
| Suggested primer 2: | GTTGCTGCAGTCCTCACAGA |