Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.119804 |
Chromosome: | chromosome 14 |
Location: | 526762 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g611484 | (1 of 4) IPR023485 - Phosphotyrosine protein phosphatase I superfamily | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTGTTGCTTTGTCAGCGTGTAACAGTAT |
Internal bar code: | GCATTGAGCTAAATAAGTCGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 606 |
LEAP-Seq percent confirming: | 79.0537 |
LEAP-Seq n confirming: | 1721 |
LEAP-Seq n nonconfirming: | 456 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGTAACCTTGCAATGCCC |
Suggested primer 2: | CCCTTGCAGATCCAATCAAT |