| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.119873 |
| Chromosome: | chromosome 12 |
| Location: | 2093299 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g509400 | RIR2L,RIR3,RIR2B | (1 of 2) K10808 - ribonucleoside-diphosphate reductase subunit M2 (RRM2); Ribonucleoside-diphosphate reductase R2-like subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAGTATAGCAACCCCGCGCATGTCGTCT |
| Internal bar code: | CTTGGCTCGAGCAGGCTGTCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 242 |
| LEAP-Seq percent confirming: | 94.6446 |
| LEAP-Seq n confirming: | 2916 |
| LEAP-Seq n nonconfirming: | 165 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATATACACTGCCTCCGT |
| Suggested primer 2: | CTTCTCCAACGTGCTCATCA |