| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.119882 |
| Chromosome: | chromosome 12 |
| Location: | 4244574 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g519150 | (1 of 1) K12169 - Kip1 ubiquitination-promoting complex protein 1 [EC:6.3.2.19] (KPC1, RNF123) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCATGCGGTGGTGGCGGCGGCAGCACA |
| Internal bar code: | AGCCGTCAACTCCGCACGTAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 232 |
| LEAP-Seq percent confirming: | 99.938 |
| LEAP-Seq n confirming: | 3224 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCTAGCATGGCACTGAGA |
| Suggested primer 2: | CATGCTGGACTGGCTCACTA |