| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.119899 |
| Chromosome: | chromosome 4 |
| Location: | 4043794 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g232602 | GRX4 | Glutaredoxin 4, CGFS type; (1 of 1) PTHR10293:SF40 - GLUTAREDOXIN-3 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCCCCTTCACTTGTTAAATGAGTGCTCAA |
| Internal bar code: | ATCGGACGGTTCCCGATACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 601 |
| LEAP-Seq percent confirming: | 99.8214 |
| LEAP-Seq n confirming: | 559 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTAGCATCCTCCACATCC |
| Suggested primer 2: | GCACTACTTGCATCCGTTGA |