| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.119964 |
| Chromosome: | chromosome 2 |
| Location: | 7847167 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141900 | (1 of 2) PTHR22811//PTHR22811:SF31 - TRANSMEMBRANE EMP24 DOMAIN-CONTAINING PROTEIN // RE49489P | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCATCCGGCACAGATGTCTACCTAGCCT |
| Internal bar code: | GGTCGGATACATAGTGGCCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 239 |
| LEAP-Seq percent confirming: | 97.871 |
| LEAP-Seq n confirming: | 1563 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGCTATCCTGTGTCACCA |
| Suggested primer 2: | TCAACACAGTGCTGGACACA |