Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.119985 |
Chromosome: | chromosome 2 |
Location: | 7895491 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g141450 | UBC14 | (1 of 1) K10688 - ubiquitin-conjugating enzyme E2 W (UBE2W, UBC16); E2 Ubiquitin conjugating enzyme | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGGTTCAGCCTCATACCTTGTCGTCCT |
Internal bar code: | CAGGGTTGCGCTATGGCCATGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 611 |
LEAP-Seq percent confirming: | 97.4755 |
LEAP-Seq n confirming: | 1390 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCTAGCCCTTCAACGCAT |
Suggested primer 2: | TTGGGGTAAGGTCCTCAATG |