| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.120033 |
| Chromosome: | chromosome 6 |
| Location: | 1951530 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g263750 | RPN15 | component of lid subcomplex of 26S proteasome regulatory subunit; (1 of 2) PF05160 - DSS1/SEM1 family (DSS1_SEM1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGGTGTTGGTTGGGCCAGGGCCTGGGT |
| Internal bar code: | CACAATGGGCGGAGTTGGTACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 736 |
| LEAP-Seq percent confirming: | 98.3777 |
| LEAP-Seq n confirming: | 66281 |
| LEAP-Seq n nonconfirming: | 1093 |
| LEAP-Seq n unique pos: | 169 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGGAGCGAGATGAGGTAG |
| Suggested primer 2: | AGCTGCTGAGAGTCTAGGCG |