Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.120091 |
Chromosome: | chromosome 8 |
Location: | 1363361 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g364000 | FAP413 | Flagellar Associated Protein 413; (1 of 1) PTHR22847//PTHR22847:SF460 - WD40 REPEAT PROTEIN // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGCTGCTGCTCGCTCGCGCGCTGCACG |
Internal bar code: | CTGTCGTGGGGTGACCCTCCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 631 |
LEAP-Seq percent confirming: | 99.8486 |
LEAP-Seq n confirming: | 8575 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCAGCTGTCATATCGCAT |
Suggested primer 2: | TCCATCCCGAGTCCTATCAG |