| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.120103 |
| Chromosome: | chromosome 2 |
| Location: | 5123928 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g105050 | (1 of 1) PTHR34810:SF1 - DNA-BINDING PROTEIN BIN4 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGTACCGAAGTGAGGACCTGCTTGTCAC |
| Internal bar code: | TCAACATTGCAATTCATATTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 903 |
| LEAP-Seq percent confirming: | 98.9848 |
| LEAP-Seq n confirming: | 780 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCACTCCTCTCCGCTTGTT |
| Suggested primer 2: | GTGGTTGCGTTTGTGTCAAC |