| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.120104 |
| Chromosome: | chromosome 10 |
| Location: | 2396253 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g435350 | ESU1,ESU1a | Endosulfine cAMP-regulated phosphoprotein; (1 of 2) PF04667 - cAMP-regulated phosphoprotein/endosulfine conserved region (Endosulfine) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTCAACGAGGGTCAGCTCCGCGCACCTT |
| Internal bar code: | TTTTCGCTCTTGTTGTTCCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 52 |
| LEAP-Seq percent confirming: | 99.5327 |
| LEAP-Seq n confirming: | 213 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGCCAAGAAGTTGAGACC |
| Suggested primer 2: | CACTGTGGGCTCTGACTTGA |