| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.120195 |
| Chromosome: | chromosome 12 |
| Location: | 2828498 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g502500 | ELG34 | Exostosin-like glycosyltransferase 34; (1 of 34) 2.4.2.41 - Xylogalacturonan beta-1,3-xylosyltransferase / Xylogalacturonan xylosyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTTGGCTTCTGAGGTGCTGACTAGGTGC |
| Internal bar code: | ACGTGTGCGAGAATAGAGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 965 |
| LEAP-Seq percent confirming: | 98.693 |
| LEAP-Seq n confirming: | 2794 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTAGCAGGACAAGGCAGG |
| Suggested primer 2: | TGAAGATCATGTGCTGAGCC |