| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.120270 |
| Chromosome: | chromosome 10 |
| Location: | 3362250 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g443950 | (1 of 2) PF04564//PF05049 - U-box domain (U-box) // Interferon-inducible GTPase (IIGP) (IIGP) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTATGCTTATAACATCGCGGTCGCGGGCA |
| Internal bar code: | GGCAAATGTTGGAATGATGTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 538 |
| LEAP-Seq percent confirming: | 99.6369 |
| LEAP-Seq n confirming: | 1372 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGGAGCCTTTAGGTGGTGT |
| Suggested primer 2: | AACCCTGGCACTAAACATGC |