| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.120321 |
| Chromosome: | chromosome 17 |
| Location: | 2282650 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g713750 | STPK16,STK16 | (1 of 1) 2.7.10.2//2.7.11.1//2.7.11.25 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Mitogen-activated protein kinase kinase kinase / MLTK; Serine/threonine protein kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTATCCAGTGTCCTTACCCAGGGGTGGC |
| Internal bar code: | CTTCGCAGTGACCTAGTGATCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 0.0 |
| LEAP-Seq n confirming: | 0 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCGACATGGTTTGGATCA |
| Suggested primer 2: | TCCACACACGCATACAACCT |