Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.120395 |
Chromosome: | chromosome 9 |
Location: | 1707348 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g396850 | (1 of 4) 2.5.1.3 - Thiamine-phosphate diphosphorylase / TMP pyrophosphorylase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTACCTAAGCTGGCAGTTGGAGTGGAACT |
Internal bar code: | GTCTGTGTACTCTTATGTGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 122 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 650 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCAAACTTTGAAAGCATCA |
Suggested primer 2: | CATACGCACCCCCTCTCTTA |