| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.120456 |
| Chromosome: | chromosome 12 |
| Location: | 7130229 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g559150 | CLPS2 | Clp protease adaptor protein; (1 of 1) PTHR33473:SF1 - ATP-DEPENDENT CLP PROTEASE ADAPTER PROTEIN CLPS | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAATTACGTCCAATGCGGCTACTGACCAC |
| Internal bar code: | GTAACCGACCAACCCAAAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 728 |
| LEAP-Seq percent confirming: | 99.8897 |
| LEAP-Seq n confirming: | 2716 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCCCTGTTAGTGGTGGAT |
| Suggested primer 2: | TGTGCACAGACAGAACTCCC |