| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.120663 |
| Chromosome: | chromosome 2 |
| Location: | 2563505 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g092850 | DLC1,LC1,ODA-LC1,DLU1 | (1 of 1) K10411 - dynein light chain 1, axonemal (DNAL1); Outer Arm Dynein Light Chain 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTATCCAGCGCAGCCAGCTTGTCGATCT |
| Internal bar code: | TCTCTAGGGACTCATCTAAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1133 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGCCTATAATGCAGGTGG |
| Suggested primer 2: | TTACAAAACCCTACGCGACC |