| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.120723 |
| Chromosome: | chromosome 14 |
| Location: | 3404994 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g630500 | TIE2 | (1 of 1) K15323 - tRNA-splicing endonuclease subunit Sen34 (TSEN34); tRNA-intron endonuclease | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGCCAGCTCTCACCAAGTATCTCTGTCC |
| Internal bar code: | GAAGACCGCCCACGCAAGCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 279 |
| LEAP-Seq percent confirming: | 28.9968 |
| LEAP-Seq n confirming: | 818 |
| LEAP-Seq n nonconfirming: | 2003 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCCCGGTTGTGAATCTGT |
| Suggested primer 2: | GGGACACACACACACACACA |