| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.120779 |
| Chromosome: | chromosome 16 |
| Location: | 4491375 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g667451 | TLP3,CAV6 | Tubby-like protein; (1 of 5) PTHR10037//PTHR10037:SF62 - VOLTAGE-GATED CATION CHANNEL CALCIUM AND SODIUM // SODIUM CHANNEL PROTEIN PARA | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAACCCCCGCCCCTTCTCTCCACTCCCCT |
| Internal bar code: | TGTGCCCATGCCGCCAATGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 537 |
| LEAP-Seq percent confirming: | 75.5162 |
| LEAP-Seq n confirming: | 256 |
| LEAP-Seq n nonconfirming: | 83 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAACACCATGCTAGTCACC |
| Suggested primer 2: | CTCACCCTGAGGTAGTCCCA |