| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.120896 |
| Chromosome: | chromosome 11 |
| Location: | 3112616 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g479050 | FAP229,FKB15-1,FKB15A,FKB1 | Peptidyl-prolyl cis-trans isomerase, FKBP-type; (1 of 1) PTHR10516//PTHR10516:SF293 - PEPTIDYL-PROLYL CIS-TRANS ISOMERASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCAAATCCCCGTTCTAATAGACACACGG |
| Internal bar code: | CTGCGGTTCGTCGCGCATATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 420 |
| LEAP-Seq percent confirming: | 92.0981 |
| LEAP-Seq n confirming: | 338 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTTTTGTGTCCGTCCGTT |
| Suggested primer 2: | CAGGCCGATTTAAGAAGTGC |