Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.120901 |
Chromosome: | chromosome 4 |
Location: | 492550 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g217930 | (1 of 1) PF06911 - Senescence-associated protein (Senescence) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGGTGAGTCAAGAATTTAAGTTTCGGGG |
Internal bar code: | TGGGTAGGTCCGTTTTTCTTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 547 |
LEAP-Seq percent confirming: | 99.637 |
LEAP-Seq n confirming: | 3019 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTGTGTGTGTGTGTGTGT |
Suggested primer 2: | CCATAATCAGGGTCCACCAC |