Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.120910 |
Chromosome: | chromosome 3 |
Location: | 5972801 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g190500 | RSW3,GLH1,GLC2A | (1 of 1) 3.2.1.84 - Glucan 1,3-alpha-glucosidase / Exo-1,3-alpha-glucanase; Glucosidase IIa | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGTCCCACACACAATCGGAATCAACCCC |
Internal bar code: | TACTTAGAAGACCTCGTGAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 160 |
LEAP-Seq percent confirming: | 99.6198 |
LEAP-Seq n confirming: | 524 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCACTGAGTGGCACAAGG |
Suggested primer 2: | CTCCTCTTCCTGCCACTGAC |