| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.121023 |
| Chromosome: | chromosome 6 |
| Location: | 4245404 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278245 | PAO9,PAO5 | Pheophorbide a oxygenase-related protein; (1 of 8) 1.14.12.20 - Pheophorbide a oxygenase / Pheide a oxygenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTCGCCAAGCGCGGATCAAGGCCAGGAT |
| Internal bar code: | CGCCCCAGATTTCGTCGGCCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 200 |
| LEAP-Seq percent confirming: | 99.7223 |
| LEAP-Seq n confirming: | 4669 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCCTGTGTCTGTCTGTC |
| Suggested primer 2: | GGGCTGGTTCGAAGATATGA |