| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.121135 |
| Chromosome: | chromosome 6 |
| Location: | 361779 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g251650 | PTC1 | (1 of 1) K14430 - phosphate transporter (PHO87_91); Low-affinity phosphate transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCCGCCGGCCTGCCCCCGCCCCTGCCG |
| Internal bar code: | ACACGTTAACTGGGCCCCGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 56 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGTGTGTAATGAAACGCC |
| Suggested primer 2: | ATTTGCTCCCGTCCCTAACT |