| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.121201 |
| Chromosome: | chromosome 10 |
| Location: | 2843670 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g439650 | COG8 | (1 of 1) PF04124 - Dor1-like family (Dor1); Component of oligomeric golgi complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTCCAGCGCATCATGGAAAGGGAAGCGT |
| Internal bar code: | TGCGCGAACGGTCATACGATTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 262 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 756 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATTTGGCACGTAGGGAACT |
| Suggested primer 2: | AGTGCTGTGATGCAAAGGTG |