| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.121248 |
| Chromosome: | chromosome 13 |
| Location: | 990544 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g568400 | FHL4,YME1,FTSH4 | FtsH-like ATPase/metalloprotease; (1 of 1) K08955 - ATP-dependent metalloprotease [EC:3.4.24.-] (YME1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGACTGCCACACAAGCGGAATGAAAAT |
| Internal bar code: | ATGAGAGTGGACGGCTGTCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 463 |
| LEAP-Seq percent confirming: | 56.7919 |
| LEAP-Seq n confirming: | 786 |
| LEAP-Seq n nonconfirming: | 598 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAGGAAGCAGTAGGGTCA |
| Suggested primer 2: | TCGACCGTCTACCACTTCCT |