| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.121295 |
| Chromosome: | chromosome 16 |
| Location: | 101224 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g695500 | MOTR2B,SAMT2 | Molybdate transporter, type 2. Member 2; (1 of 2) PTHR23516:SF1 - MOLYBDATE-ANION TRANSPORTER | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAGAGCACCAACGCAGTGTCAACAACTC |
| Internal bar code: | TTGTAAACTTGCGTGATAGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 367 |
| LEAP-Seq percent confirming: | 76.4618 |
| LEAP-Seq n confirming: | 1530 |
| LEAP-Seq n nonconfirming: | 471 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCCACAACACAGTACGGC |
| Suggested primer 2: | AACAACATCAGCACCAGCAG |