Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.121343 |
Chromosome: | chromosome 4 |
Location: | 2615465 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g222700 | ABC4,EF3 | (1 of 2) K03235 - elongation factor 3 (EF3, TEF3); Elongation Factor 3 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCTGTCTGGTCTAGTGCCAGGCTCAGGT |
Internal bar code: | GGGGTCCGAGGATGACATGGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 871 |
LEAP-Seq percent confirming: | 99.821 |
LEAP-Seq n confirming: | 2231 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCTCCTCAATCCGAATCA |
Suggested primer 2: | TGGTTAAGGTCGTGGTGTGA |