Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.121404 |
Chromosome: | chromosome 8 |
Location: | 1299055 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g363750 | (1 of 2) K06268 - serine/threonine-protein phosphatase 2B regulatory subunit (PPP3R, CNB) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCCGGAAGCCTAACCTGCCCAAGGCCA |
Internal bar code: | TAAACCGTGGAAGTACGTCGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 105 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 37 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGCGTCTACCTCATCTCC |
Suggested primer 2: | CACCCTTGCACATCAACATC |