| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.121404 |
| Chromosome: | chromosome 8 |
| Location: | 1299055 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g363750 | (1 of 2) K06268 - serine/threonine-protein phosphatase 2B regulatory subunit (PPP3R, CNB) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGGCAGGGATCATCAGCGTATGGATGC |
| Internal bar code: | TTGAGTATCACTTAGCTGTACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 483 |
| LEAP-Seq percent confirming: | 99.6231 |
| LEAP-Seq n confirming: | 2379 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAGCGTCTACCTCATCTCC |
| Suggested primer 2: | CACCCTTGCACATCAACATC |